Jurassic Park Easter Egg - Who Made the DNA?

OK. In Jurassic Park, Henry Wu (the geneticist) shows the visitors a piece of 'Dino DNA' taken, he says, from a dinosaur.

The way DNA works is to have groups of 3 letters, made from combinations of A, G, C or T, each coding for a chemical known as an amino acid. There are 20 amino acids, each has a single letter code name.

Someone actually pieced out what the DNA coded for, in single letters, then looked this up in the universal protein database, to see what it was. It's actually a chicken protein. But after about 150 letters, the chicken protein breaks for a while to say 'MARK WAS HERE' then back to chicken protein, and a bit further on the word 'NIH' has been put in too.

So Mark put the DNA sequence together for Mr. Crichton, I presume...

(by the way, I find this quite fun, as I'm a biochemist...)

User Rating:
7.0
  7.0/10 with 541 votes
Contributed By: Mish on 07-31-2000
Reviewed By: Webmaster
Special Requirements: eyes
Please correct this Egg if you see errors.

Pictures and Videos

None posted yet. Send us yours and be the first!

Comments

-=AoD=- writes:
In response to the idiot above aka (Smaug), because he pollutes this site with dumb posts (smog get it?), you should learn to read. Mish did explain quite clearly as a biology student working for a bio tech I would have to say that "The way DNA works is to have groups of 3 letters, made from combinations of A, G, C or T, each coding for a chemical known as an amino acid." explains it quite well for a general description. Your quote was "My comment: it is even quite interesting to see a biochemist thinking that an amino acid is represented by a single letter an not by a base triplet (three letters) :-)", but see he did say groups of 3 letters please pay more attention before acting smug and making comments about things you do not understand obviously your envy comes from your lack of knowledge thus making you want to lower the assumed intelligence of others. Please feel free to mail me with any questions :-)
17 of 25 people found this comment helpful. Did you? Yes No
Sam writes:
Would you all like to know the real deal with this egg? Well I don't really care if you do or not -- I'll tell you anyway! (This is all taken from my copy of a great book titled 'The Science of Jurassic Park' by DeSalle & Lindley) Mark Boguski is an NIH (National Institutes of Health) scientist who works at the National Canter for Biotechnology and Information, and specializes in the database storage and retrieval software. He's the person who first identified the DNA sequence in 'Jurassic Park' [the book] as that of an E. coli plasmid instead of a dinosaur, and he wrote to Crichton about the error. Crichton then asked Boguski to provide a more authentic sequence for 'The Lost World' [also the book]. So this "Mark" person decided that since dinosaurs are related very closely to modern birds, what better DNA strand to provide then that of a chicken. Mark actually sent in the blue-prints for the "erythroid transcription factor" protein of a chicken. Then, knowing full well that, in the future, people would be arguing over this very topic, Mark tweaked the DNA sequence just a bit so that, when translated, one gets 14 more amino acids then the chicken’s protein should really have. These 14 acids are grouped into 4 blocks, and the initial letters of those 4 blocks’ names spell out MARK WAS HERE NIH. Thus, Dr. Mark Boguski of NIH gets credit for his research along with a little something to laugh with his co-workers about around the water cooler -- and, likewise, nerds like us are given fodder for a good debate. Thank you for your time. S.M.B..
9 of 11 people found this comment helpful. Did you? Yes No
Mish writes:
Gah. Can of worms. Couple of things... - I didn't try and pass it off as my own. Or at least, that wasn't my intention. (Note I did say that 'Someone actually pieced out what the DNA coded for' not 'I did this...') - JP was a book first, then a film. Hence a literary egg. I don't even know if this bit of DNA appeared in the film. - That bit of DNA earlier looks like the wrong one. There's quite a few in the book. I haven't got the book with me here but I did check all three reading frames in it and there was no message. Regarding the 'code' I was using - there wouldn't be a different one; pretty much everything uses the same code. OK, there are a couple of exceptions (I think there's a sea squirt or something which is slightly different, not sure why) so whatever code you've got is right. Look at http://bio.lundberg.gu.se/edu/translat.html if you want a thing to do it for you. The bit of DNA there appears to have part of a Salmonella protein in it. That may just be coincidence... Hope all of this helps Mish
12 of 18 people found this comment helpful. Did you? Yes No
XWiz writes:
The whole story is actually listed in the book 'The Science Of Jurassic Park' which has been published for years and years and years now... the information above is virtually verbatim - nice attempt to pass off someone else's work as your own! :)
7 of 12 people found this comment helpful. Did you? Yes No
Peter writes:
While i think this egg is pretty cool, i just want to say that you people have WAY too much spare time.
7 of 13 people found this comment helpful. Did you? Yes No
zoso dude writes:
Stop arguing, we'll probably never know the answer. I'll make you stop! NI! NI! NI!
2 of 3 people found this comment helpful. Did you? Yes No
nikki w. writes:
This is a literary egg. I love the book Jurassic Park and am sitting here with it in my hand. the DNA strand is written out like: GCGTTGCTGGCGTTTTCCAGGCT making it possible to have the egg mark was here written out in the DNA strand. The movie never really went into great depths with the DNA strand since it is too scientific for average people to understand.
1 of 2 people found this comment helpful. Did you? Yes No
UnjustRuler writes:
Are you sure the 'nih' isn't a reference to Monty Python and the Holy Grail? I understand biochemists are into that whole 'cult' scene....
3 of 6 people found this comment helpful. Did you? Yes No
Nilhag Dmaa writes:
The sequence from the book is: 1 GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC 61 GGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG 121 TGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGC 181 TGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTG 241 CCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAA 301 AGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAG 361 ATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACT 421 CCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCT 481 GGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGG 541 CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA 601 CGGCTCTTACCAGCCTAACTTCGATCACTGGACCGCTGATCGTCACGGCGATTTATGCCG 661 CACATGGACGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAA 721 CAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAA 781 GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG 841 CTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTG 901 ACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCA 961 ACACGACTTAACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACCTTGTCTGCCTCCCC 1021 GCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGG 1081 CCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGG 1141 CCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCT 1201 GCGCATGATCGTGCTAGCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACT 1281 ATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTGCGACCT 1341 ATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAACGCGGAAGTCAGCGCCCTG However, in the only code which I could find on the Internet, it is represented by: ALLAFFHRLRPPDEHHKNRRGGETRQDTKDTRRFPLEAPSCSDPAATRIPVRLSPFGKRGCSRCRTLSSVsVVRSKLGCVPFSPTAAPTPVTIVLSPTRsSRTGAGSALGHFRRGPLSLEIGLSLAVFGILHALAQAFVTPNVSARSRPLSPAWRPTRWAGVRDARLDGLPHTDSSRFRRPALQAMLSRQVDDDHQGQLQRLLPAsLRSLDRsSSRRFMPHMDALLAFFHRLRPPDEHHKQVRGGETRQDTKDTRRFPLEALSCSDPAATRIPVRLSPFGLSQCSRCRTLSSVsVVRSKLTNPPFSPTAAPTPVTIVLSPTRLNGLAWIVGAALTLVCLPAVHGAGPPRPEWKPAAPRsRPRIGANQFLRRTVNAQTNPWPSRPPSPAAARGASRAALGPAHDRASLSLRTRLGWRGCLTMNHRTASEREATAAAKRLRPMNGLRFPCFVKSGNAEVSAL I don't know about you, but I can't find anything in there that looks like an english sentance. Were you using a different code set? The one which I used was found at http://www.algoart.com/help/softstep/alldocs/aatable.htm Possibly the book has a different sequence than the movie? -mwars
7 of 14 people found this comment helpful. Did you? Yes No
Jabroni writes:
Actually, the word "NIH" is not a mistake, and definitely does not stand for "Nine Inch Nails"! It actually stands for "National Institutes for Health", located in Bethesda Maryland.
1 of 4 people found this comment helpful. Did you? Yes No
Fixer writes:
NIH stands for NATIONAL INSTITUTES of HEALTH which is in Bethesda, my dad actually works there, the movie makers probably got the genetic code from one of the labs there
2 of 6 people found this comment helpful. Did you? Yes No
Fixer, that makes sense. Mr. Crichton probably asked the N.I.H. for help in creating a plausible dinosaur D.N.A. string. And I'll give you three guesses as to who created it for him... Why ask the N.I.H.? I'm not entirely sure since it doesn't make all that much sense. My only guess is that they do use animals for experimental purposes (see http://www.nih.gov/science/models/), so they would have to be somewhat familiar with sequencing D.N.A. Or maybe Michael Crichton had a friend named Mark who just happens to work at the N.I.H. who helped him out with his book by creating the D.N.A. strand... Or maybe it really does say "|\| | |/|" and the National Institutes of Health have nothing to do with this egg at all...
1 of 4 people found this comment helpful. Did you? Yes No
XWiz writes:
Crichton was contacted by someone who complained that the DNA sequences were unrealistic. He responded and was sent the snippet as included in the book. Like I said, the whole story is actually listed in the book 'The Science Of Jurassic Park'...
2 of 6 people found this comment helpful. Did you? Yes No
Neverware writes:
DNA stands for DeoxyriboNucleic Acid (capitalized due to the absence of italics). The letters are not meant to represent any combination of the acids.
2 of 6 people found this comment helpful. Did you? Yes No
Nilhag Dmaa writes:
Could the author of this post (Mish) please tell us what set of standard letters he used? This would be helpful for verification purposes.
0 of 2 people found this comment helpful. Did you? Yes No
Nilhag Dmaa writes:
Anyone who has read the book (not JP, the one which revealed this egg), or knows otherwise, which DNA sequence in the book (JP) is this a reference to? The one which I typed is the only complete sequence which I could find. Any information is appreciated!
1 of 4 people found this comment helpful. Did you? Yes No
Tigerz writes:
Look, guys, I know this will probably not be helpful at all, but SIMPLIFY! I mean, I read classics and everything, and I am not stupid, but please, not everyone is a biologist... considering that I am only a teenager.
1 of 4 people found this comment helpful. Did you? Yes No
Hypatia writes:
I think this might clear up the confusion. Scroll down to the BLAST problems (in a big green header). The first problem deals with the DNA code in Jurassic park and the subsequent sequence in the Lost World. http://www.ncbi.nlm.nih.gov/Class/FieldGuide/problem_set.html
0 of 2 people found this comment helpful. Did you? Yes No
Jonny T writes:
It counts as a literary egg because Jurrasic Park was a book many years before it was made into a film. This is true of many films - they start out life as books and are made into films by Hollywood people.
1 of 5 people found this comment helpful. Did you? Yes No
stickyvicky writes:
Scientists ARE average people.
1 of 5 people found this comment helpful. Did you? Yes No
Revegelance writes:
This is a cool egg, and very clever indeed. Jurassic Park was an excellent book, but the movie just plain sucks.
3 of 9 people found this comment helpful. Did you? Yes No
blueselene writes:
What do you mean you think it is surprising that a biochemist would refer to an amino acid with a single letter? Amino acids are coded with three bases per acid, for example, the amino acid alanine could be coded by the triplets GCU, GCC, GCA, or GCG (there are 64 combinations possible and only 20 amino acids, so there is more than one code for each amino acid). However, if one is writing out the amino acid sequence of a protein they are not going to write alanine, serine, arginine, etc. They instead use a three letter code (in this case, ala, ser, arg...) or a one letter code that represents each amino acid (A, S, R in this case.) Just though I would clear this up. I'm not a biochemist, but I am a biology major who has had plenty of classes in genetics and biochemistry. (And no, I can't verify the correct sequence or that it really says "MARK IS HERE." I'm not that into the book!) Thanks.
1 of 5 people found this comment helpful. Did you? Yes No
I'm nowhere near biochemistry myself, but admittedly - this is a good one.
0 of 4 people found this comment helpful. Did you? Yes No
Holden writes:
This is cool. I like this egg.
1 of 6 people found this comment helpful. Did you? Yes No
RStacey writes:
Iris is correct , this is not a literary egg - it should be in the Film section. How can you "see" a strand of DNA in a book ? To find the egg in the book, the DNA would have to be described in detail , therefore spelling out the very words that are the egg !
1 of 6 people found this comment helpful. Did you? Yes No
Casquivana writes:
Question - what does NIH mean anyway?
0 of 4 people found this comment helpful. Did you? Yes No
abel writes:
Someone mustve been really bored to actually sit down and sequence the DNA in the book.
5 of 14 people found this comment helpful. Did you? Yes No
gamefreak911 writes:
Casquivana-it actually isn't nih as most people think but it was meant to be the symbol for a band called nine inch nails. their symbol for their band is three letters an N a I and a backwards N so you see it isn't nih but actually is nine inch nails abbreviated. P.S. they are a great band
0 of 11 people found this comment helpful. Did you? Yes No


Register - Privacy Policy - About Us - Contact Us